Home
The CKB site
DNA Pattern search
DNA Pattern Find accepts one or more sequences along with a search pattern and returns the number and positions of sites that match the pattern. Use DNA Pattern Find to locate sequence regions that match a consensus sequence of interest.
Paste a raw sequence or one or more FASTA sequences into the text area below. White space and digits are removed before the pattern matching is performed. Input limit is 500000 characters.
>sample sequence one ttaaggaccccatgccctcgaataggcttgagcttgccaattaacgcgcacgggctggccgggcgtataagccaaggtgtagtgaggttgcattatacatgccggcttgtgattaacgcatgccataggacggttaggctcagaacccgcaaccaatacacgtgattttctcgtcccctg >sample sequence two aggcgtatgcgatcctgaccatgcaaaactccagcgtaaatacctagccatggcgacacaaggcgcaagacaggagatgacggcgtttagatcggcgaaatattaaagcaaacgacgatgacttcttcgggaaattagttccctactcgtgtactccaattagccataacactgttcgtcaagatatagggggtcacccatgaatgtcctctaaccagaccatttcgttacacgaacgtatct >sample sequence three tactcagggctccagaggtacaagttggtaatcggttaggtgtatcgccgccaggggtgcgtcgtcatgactcggttaga
Enter the
search pattern
to be used. The default pattern "ctt[ca]" searches for occurrences of "cttc" and "ctta".
